Gene/Protein Characteristic Table for mFLJ00346

Length: 3778 bp

Restriction map

Length of 3'UTR	390 bp
Genome contig ID	gi65553144f_24287329
PolyA signal sequence (None)	+----*----+----*----+----*----+---- TGTGGACAGAAGAGTGGAACACTGTCCAGCAACCT
Flanking genome sequence (154141 - 154190)	----+----*----+----*----+----*----+----*----+----* ATTCCGAGTGAATTTCACTCATCCCTTTGGTGAGAAGAAAAGATAAAACT

KIAA	Alignment based on:
FLJ00346	DNA sequence, AA sequence, Physical map

Coding region: 2..3388

Length: 1128 aa

Entry Exp ID% Protein Source BAD21430 0 100.0 mFLJ00346 prote... Mus musculus EDL41626 0 99.5 mCG18046, isofo... Mus musculus AAH30316 0 99.5 Dock8 protein [... Mus musculus AAI41359 0 99.5 Dedicator of cy... Mus musculus Q8C147 0 99.5 Dedicator of cy... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122554 1.4e-197 69.1 mKIAA1771 AK129348 2.2e-185 54.8 mKIAA1395 AK122347 7.8e-81 30.9 mKIAA0694 AK122431 3.5e-63 32.2 mKIAA1058 AK122353 1.7e-10 23.0 mKIAA0716

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010703	911	1090	PF06920	Dedicator of cytokinesis

Method	From	To	amino acid sequence
SOSUI	1	23	FKLLVILLQPAISWVLGLQVKSM
	76	98	KINISLAFFLYDLLSIMDRGFVF
	239	261	KIAALYLPLVGIILDALPQLYDF