ROUGE

Gene/Protein Characteristic Table for mFLJ00343

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131179
Description :	Filamin A.
Clone Name :	mpf00791 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6178 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 319 bp

Genome contig ID gi66880665r_68784127
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTCCCAGCCAAGAGGAATAAAATTTTGCTTCCGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTCCTGTGAATGTAGCTTTCATGGAAGGAGTAATGGAAGGCCAAACTAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00343 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00343	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..5859
Length: 1952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21429	100.0	mFLJ00343 prote...	Mus musculus
EDL29839	100.0	mCG21234, isofo...	Mus musculus
CAT00727	99.9	filamin, alpha ...	Mus musculus
EDL29838	99.6	mCG21234, isofo...	Mus musculus
Q8BTM8	99.6	Filamin-A; Alph...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220343	0.00014	26.2	mKIAA0517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001298 1 73 PF00630 Filamin/ABP280 repeat

IPR001298 79 176 PF00630 Filamin/ABP280 repeat

IPR001298 182 275 PF00630 Filamin/ABP280 repeat

IPR001298 281 371 PF00630 Filamin/ABP280 repeat

IPR001298 377 464 PF00630 Filamin/ABP280 repeat

IPR001298 470 559 PF00630 Filamin/ABP280 repeat

IPR001298 565 659 PF00630 Filamin/ABP280 repeat

IPR001298 665 752 PF00630 Filamin/ABP280 repeat

IPR001298 758 849 PF00630 Filamin/ABP280 repeat

IPR001298 855 946 PF00630 Filamin/ABP280 repeat

IPR001298 952 1042 PF00630 Filamin/ABP280 repeat

IPR001298 1078 1162 PF00630 Filamin/ABP280 repeat

IPR001298 1167 1254 PF00630 Filamin/ABP280 repeat

IPR001298 1266 1341 PF00630 Filamin/ABP280 repeat

IPR001298 1349 1436 PF00630 Filamin/ABP280 repeat

IPR001298 1462 1532 PF00630 Filamin/ABP280 repeat

IPR001298 1540 1627 PF00630 Filamin/ABP280 repeat

IPR001298 1634 1722 PF00630 Filamin/ABP280 repeat

IPR001298 1731 1818 PF00630 Filamin/ABP280 repeat

IPR001298 1859 1948 PF00630 Filamin/ABP280 repeat

ProfileScan IPR001298 1 76 PS50194 Filamin/ABP280 repeat

IPR001298 77 179 PS50194 Filamin/ABP280 repeat

IPR001298 180 278 PS50194 Filamin/ABP280 repeat

IPR001298 279 374 PS50194 Filamin/ABP280 repeat

IPR001298 375 467 PS50194 Filamin/ABP280 repeat

IPR001298 468 562 PS50194 Filamin/ABP280 repeat

IPR001298 563 662 PS50194 Filamin/ABP280 repeat

IPR001298 663 755 PS50194 Filamin/ABP280 repeat

IPR001298 756 852 PS50194 Filamin/ABP280 repeat

IPR001298 853 949 PS50194 Filamin/ABP280 repeat

IPR001298 950 1045 PS50194 Filamin/ABP280 repeat

IPR001298 1084 1165 PS50194 Filamin/ABP280 repeat

IPR001298 1165 1257 PS50194 Filamin/ABP280 repeat

IPR001298 1255 1344 PS50194 Filamin/ABP280 repeat

IPR001298 1347 1439 PS50194 Filamin/ABP280 repeat

IPR001298 1437 1535 PS50194 Filamin/ABP280 repeat

IPR001298 1538 1630 PS50194 Filamin/ABP280 repeat

IPR001298 1632 1725 PS50194 Filamin/ABP280 repeat

IPR001298 1729 1821 PS50194 Filamin/ABP280 repeat

IPR001298 1857 1951 PS50194 Filamin/ABP280 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001298	1	73	PF00630	Filamin/ABP280 repeat
IPR001298	79	176	PF00630	Filamin/ABP280 repeat
IPR001298	182	275	PF00630	Filamin/ABP280 repeat
IPR001298	281	371	PF00630	Filamin/ABP280 repeat
IPR001298	377	464	PF00630	Filamin/ABP280 repeat
IPR001298	470	559	PF00630	Filamin/ABP280 repeat
IPR001298	565	659	PF00630	Filamin/ABP280 repeat
IPR001298	665	752	PF00630	Filamin/ABP280 repeat
IPR001298	758	849	PF00630	Filamin/ABP280 repeat
IPR001298	855	946	PF00630	Filamin/ABP280 repeat
IPR001298	952	1042	PF00630	Filamin/ABP280 repeat
IPR001298	1078	1162	PF00630	Filamin/ABP280 repeat
IPR001298	1167	1254	PF00630	Filamin/ABP280 repeat
IPR001298	1266	1341	PF00630	Filamin/ABP280 repeat
IPR001298	1349	1436	PF00630	Filamin/ABP280 repeat
IPR001298	1462	1532	PF00630	Filamin/ABP280 repeat
IPR001298	1540	1627	PF00630	Filamin/ABP280 repeat
IPR001298	1634	1722	PF00630	Filamin/ABP280 repeat
IPR001298	1731	1818	PF00630	Filamin/ABP280 repeat
IPR001298	1859	1948	PF00630	Filamin/ABP280 repeat
ProfileScan	IPR001298	1	76	PS50194	Filamin/ABP280 repeat
IPR001298	77	179	PS50194	Filamin/ABP280 repeat
IPR001298	180	278	PS50194	Filamin/ABP280 repeat
IPR001298	279	374	PS50194	Filamin/ABP280 repeat
IPR001298	375	467	PS50194	Filamin/ABP280 repeat
IPR001298	468	562	PS50194	Filamin/ABP280 repeat
IPR001298	563	662	PS50194	Filamin/ABP280 repeat
IPR001298	663	755	PS50194	Filamin/ABP280 repeat
IPR001298	756	852	PS50194	Filamin/ABP280 repeat
IPR001298	853	949	PS50194	Filamin/ABP280 repeat
IPR001298	950	1045	PS50194	Filamin/ABP280 repeat
IPR001298	1084	1165	PS50194	Filamin/ABP280 repeat
IPR001298	1165	1257	PS50194	Filamin/ABP280 repeat
IPR001298	1255	1344	PS50194	Filamin/ABP280 repeat
IPR001298	1347	1439	PS50194	Filamin/ABP280 repeat
IPR001298	1437	1535	PS50194	Filamin/ABP280 repeat
IPR001298	1538	1630	PS50194	Filamin/ABP280 repeat
IPR001298	1632	1725	PS50194	Filamin/ABP280 repeat
IPR001298	1729	1821	PS50194	Filamin/ABP280 repeat
IPR001298	1857	1951	PS50194	Filamin/ABP280 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	319 bp
Genome contig ID	gi66880665r_68784127
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCCCAGCCAAGAGGAATAAAATTTTGCTTCCGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTCCTGTGAATGTAGCTTTCATGGAAGGAGTAATGGAAGGCCAAACTAGC

Gene/Protein Characteristic Table for mFLJ00343

Features of the cloned DNA sequence

Features of the protein sequence