ROUGE

Gene/Protein Characteristic Table for mFLJ00324

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC057083
Description :
Clone Name :	mbj00894 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2539 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1341 bp

Genome contig ID gi65519420f_59606120
PolyA signal sequence
(TATAAA,-23)
+----*----+----*----+----*----+----
CAGTGGGTGCCATATAAAGCTGGTCAATGGTGGTG
Flanking genome sequence
(117934 - 117983)
----+----*----+----*----+----*----+----*----+----*
CTTCCTGCCTGCTTCTGTGAGATGGGCAAATGAGTCAGCTTAGCACACCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00324 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00324	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 152..1198
Length: 348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC28635	9.8e-116	100.0	unnamed protein...	Mus musculus
Q7TN33	1.2e-115	100.0	CUG-BP- and ETR...	Mus musculus
EDL25972	1.2e-115	100.0	bruno-like 6, R...	Mus musculus
EDL25973	9.9e-115	99.7	bruno-like 6, R...	Mus musculus
EDL95701	6.6e-113	97.7	bruno-like 6, R...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 24 95 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 265 336 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

HMMSmart IPR000504 23 98 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 264 337 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

ProfileScan IPR000504 22 102 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 263 341 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	24	95	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	265	336	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	23	98	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	264	337	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR000504	22	102	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	263	341	PS50102	RNA-binding region RNP-1 (RNA recognition motif)

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1341 bp
Genome contig ID	gi65519420f_59606120
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- CAGTGGGTGCCATATAAAGCTGGTCAATGGTGGTG
Flanking genome sequence (117934 - 117983)	----+--------+--------+--------+--------+----* CTTCCTGCCTGCTTCTGTGAGATGGGCAAATGAGTCAGCTTAGCACACCA

Gene/Protein Characteristic Table for mFLJ00324

Features of the cloned DNA sequence

Features of the protein sequence