ROUGE

Gene/Protein Characteristic Table for mFLJ00292

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220206
Description :
Clone Name :	msp02004 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 520 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 17 bp

Genome contig ID gi65535943r_54694067
PolyA signal sequence
(AATGAA,-22)
+----*----+----*----+----*----+----
CAGGAGACAGATGAATGAACCGGGAAAACTCTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAAGAGACTCCCCCTGTTTTGGGGGAGGCAACTCATGAACTCTCGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00292 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00292	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..503
Length: 166 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90131	2.7e-73	100.0	mFLJ00292 prote...	Mus musculus
Q8JZM6	2.6e-63	100.0	TRAF-interactin...	Mus musculus
AAH05528	2.8e-61	98.0	Tifab protein [...	Mus musculus
Q5BK67	1.2e-58	91.8	TRAF-interactin...	Rattus norvegicus
XP_527016	6.5e-51	74.7	similar to FLJ0...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 55 127 PF00498 Forkhead-associated

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	55	127	PF00498	Forkhead-associated

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	17 bp
Genome contig ID	gi65535943r_54694067
PolyA signal sequence (AATGAA,-22)	+--------+--------+----*----+---- CAGGAGACAGATGAATGAACCGGGAAAACTCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAAGAGACTCCCCCTGTTTTGGGGGAGGCAACTCATGAACTCTCGAG

Gene/Protein Characteristic Table for mFLJ00292

Features of the cloned DNA sequence

Features of the protein sequence