ROUGE

Gene/Protein Characteristic Table for mFLJ00277

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131170
Description :	Membralin splice variant 2 (Fragment).
Clone Name :	mph01638 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3112 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2471 bp

Genome contig ID gi65524842r_79997838
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGGGTTATACAGAGAAATCCTGTCTTGAAAAACC
Flanking genome sequence
(99745 - 99696)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAGAAAAGAATGGGGGTGTGGTCATGATTGGAGCTGGAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00277 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00277	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 36..641
Length: 201 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21420	3e-63	100.0	mFLJ00277 prote...	Mus musculus
AAI00298	1.7e-53	97.8	ORF61 protein [...	Mus musculus
AAH05494	2.2e-53	97.8	ORF61 protein [...	Mus musculus
AAH52787	2.2e-53	97.8	ORF61 protein [...	Mus musculus
AAM34492	2.4e-53	97.8	membralin splic...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2471 bp
Genome contig ID	gi65524842r_79997838
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGGGTTATACAGAGAAATCCTGTCTTGAAAAACC
Flanking genome sequence (99745 - 99696)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGAAAAGAATGGGGGTGTGGTCATGATTGGAGCTGGAGG

Gene/Protein Characteristic Table for mFLJ00277

Features of the cloned DNA sequence

Features of the protein sequence