ROUGE

Gene/Protein Characteristic Table for mFLJ00264

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131169
Description :
Clone Name :	mfj20268 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4494 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1345 bp

Genome contig ID gi65504368r_42666184
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TCTCAACTAATAAAAATGAAGAAAATGCTAGATAT
Flanking genome sequence
(99699 - 99650)
----+----*----+----*----+----*----+----*----+----*
AAATCCTGCTTTTCTTGTGATTTCTCTTACACTCAACACTTTGGCTTGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00264 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00264	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 165..3149
Length: 994 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21419	100.0	mFLJ00264 prote...	Mus musculus
Q921K8	100.0	Protein FAM115C...	Mus musculus
AAH08555	99.3	Fam115c protein...	Mus musculus
XP_001072414	88.1	hypothetical pr...	Rattus norvegicus
XP_001057103	88.1	hypothetical pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173013	0	60.4	mKIAA0738

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1345 bp
Genome contig ID	gi65504368r_42666184
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TCTCAACTAATAAAAATGAAGAAAATGCTAGATAT
Flanking genome sequence (99699 - 99650)	----+--------+--------+--------+--------+----* AAATCCTGCTTTTCTTGTGATTTCTCTTACACTCAACACTTTGGCTTGGT

Gene/Protein Characteristic Table for mFLJ00264

Features of the cloned DNA sequence

Features of the protein sequence