ROUGE

Gene/Protein Characteristic Table for mFLJ00240

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131164
Description :
Clone Name :	mbg05043 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4647 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 935 bp

Genome contig ID gi65540054f_49908623
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CCCACTTGTATAGAATTAAAAAAAAAATCACTGTC
Flanking genome sequence
(117175 - 117224)
----+----*----+----*----+----*----+----*----+----*
TGCCTCTGGTCTCTGCTGTGCAAGCTTTGCATTTTTCCCACACACACACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00240 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00240	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 524..2293, 3789..4328
Length: 769 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21414	0	100.0	mFLJ00240 prote...	Mus musculus
BAE28502	3.2e-177	100.0	unnamed protein...	Mus musculus
Q3UFQ8	4.4e-177	60.6	Leucine-rich re...	Mus musculus
Q5XHY1	5.8e-176	59.2	Leucine-rich re...	Rattus norvegicus
Q8ND23	1.6e-175	57.3	Leucine-rich re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003590 129 156 SM00368 Leucine-rich repeat

IPR003590 190 219 SM00368 Leucine-rich repeat

IPR003590 307 336 SM00368 Leucine-rich repeat

IPR003590 425 452 SM00368 Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003590	129	156	SM00368	Leucine-rich repeat
IPR003590	190	219	SM00368	Leucine-rich repeat
IPR003590	307	336	SM00368	Leucine-rich repeat
IPR003590	425	452	SM00368	Leucine-rich repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	935 bp
Genome contig ID	gi65540054f_49908623
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCCACTTGTATAGAATTAAAAAAAAAATCACTGTC
Flanking genome sequence (117175 - 117224)	----+--------+--------+--------+--------+----* TGCCTCTGGTCTCTGCTGTGCAAGCTTTGCATTTTTCCCACACACACACC

Gene/Protein Characteristic Table for mFLJ00240

Features of the cloned DNA sequence

Features of the protein sequence