ROUGE

Gene/Protein Characteristic Table for mFLJ00220

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220310
Description :	Chordin precursor.
Clone Name :	mbh04436 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4406 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1830 bp

Genome contig ID gi65546577f_19407314
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TTTTTTGTATTTATTAAAACATCTTTTTTTCAGTC
Flanking genome sequence
(106178 - 106227)
----+----*----+----*----+----*----+----*----+----*
TTTGGGTTTGAGGTAGGCTCTTTGTGGCCAGGACCCCAGTGGGCGCCAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00220 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00220	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1932..2576
Length: 214 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90387	1.1e-80	100.0	mFLJ00220 prote...	Mus musculus
EDK97595	9.2e-43	84.0	chordin, isofor...	Mus musculus
BAE28881	1.4e-42	84.0	unnamed protein...	Mus musculus
Q9Z0E2	1.4e-42	84.0	Chordin; Flags:...	Mus musculus
AAI45697	1.4e-42	84.0	Chrd protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001007 118 204 SM00214 von Willebrand factor

ProfileScan IPR001007 116 205 PS50184 von Willebrand factor

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001007	118	204	SM00214	von Willebrand factor
ProfileScan	IPR001007	116	205	PS50184	von Willebrand factor

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1830 bp
Genome contig ID	gi65546577f_19407314
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TTTTTTGTATTTATTAAAACATCTTTTTTTCAGTC
Flanking genome sequence (106178 - 106227)	----+--------+--------+--------+--------+----* TTTGGGTTTGAGGTAGGCTCTTTGTGGCCAGGACCCCAGTGGGCGCCAGT

Gene/Protein Characteristic Table for mFLJ00220

Features of the cloned DNA sequence

Features of the protein sequence