ROUGE |
Gene/Protein Characteristic Table for mFLJ00217 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131160 |
---|---|
RING finger protein 31. | |
mbh01524 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4939 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 85 bp Genome contig ID gi65540054f_50011018 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGTTCCAGCACCAATAAAGAGGCATCTTATGGCCTFlanking genome sequence
(110666 - 110715) ----+----*----+----*----+----*----+----*----+----*
AGGCTTCTTGGTGGTCCTTCTTCCTGGCCTCAGCATCCCGGGGCATTAGG
KIAA Alignment based on: FLJ00217 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1303..1989, 3769..4854
Length: 590 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |