ROUGE

Gene/Protein Characteristic Table for mFLJ00216

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131159
Description :	Weakly similar to UDP-N-ACTEYLGLUCOSAMINE pyrophosphorylase 1 (Fragment).
Clone Name :	msk07072 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 1592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 484 bp

Genome contig ID gi66880554r_25193668
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAGATTGGGACCTCTTGGATCCCCCCCCCCATGG
Flanking genome sequence
(99986 - 99937)
----+----*----+----*----+----*----+----*----+----*
ACTCTGATTGTCTGTCTATTTTTTTGTTTTGTTTTTGCCTTCTTGCTGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00216 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00216	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..1018, 1107..1343
Length: 418 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21409	4.4e-179	100.0	mFLJ00216 prote...	Mus musculus
Q3TW96	3.8e-143	88.9	UDP-N-acetylhex...	Mus musculus
AAH43307	3.8e-143	88.9	Uap1l1 protein ...	Mus musculus
BAC37059	3.8e-143	88.9	unnamed protein...	Mus musculus
AAI68670	1.1e-135	83.8	Uap1l1 protein ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002618 35 418 PF01704 UTP--glucose-1-phosphate uridylyltransferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002618	35	418	PF01704	UTP--glucose-1-phosphate uridylyltransferase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	484 bp
Genome contig ID	gi66880554r_25193668
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAGATTGGGACCTCTTGGATCCCCCCCCCCATGG
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* ACTCTGATTGTCTGTCTATTTTTTTGTTTTGTTTTTGCCTTCTTGCTGGC

Gene/Protein Characteristic Table for mFLJ00216

Features of the cloned DNA sequence

Features of the protein sequence