ROUGE |
Gene/Protein Characteristic Table for mFLJ00216 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131159 |
---|---|
Weakly similar to UDP-N-ACTEYLGLUCOSAMINE pyrophosphorylase 1 (Fragment). | |
msk07072 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1592 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 484 bp Genome contig ID gi66880554r_25193668 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAGATTGGGACCTCTTGGATCCCCCCCCCCATGGFlanking genome sequence
(99986 - 99937) ----+----*----+----*----+----*----+----*----+----*
ACTCTGATTGTCTGTCTATTTTTTTGTTTTGTTTTTGCCTTCTTGCTGGC
KIAA Alignment based on: FLJ00216 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1018, 1107..1343
Length: 418 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |