ROUGE

Gene/Protein Characteristic Table for mFLJ00215

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC054802
Description :
Clone Name :	mbh04250 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4673 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2270 bp

Genome contig ID gi65488608f_179400649
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCAAATCAAGCTTGTAATTTAAAATCTACACCAAC
Flanking genome sequence
(181074 - 181123)
----+----*----+----*----+----*----+----*----+----*
AAAATGTCTCCGAGAATTTATTTGAACCCTTTGGGTGTTGGGGGACGTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00215 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00215	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 244..2403
Length: 719 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8CBC4	0	100.0	Uncharacterized...	Mus musculus
XP_573525	5.2e-204	83.8	hypothetical pr...	Rattus norvegicus
EDL94811	1.7e-163	84.4	rCG20445 [Rattu...	Rattus norvegicus
AAH34107	2.3e-145	100.0	9630058J23Rik p...	Mus musculus
XP_854662	3.3e-139	61.7	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 658 680 SCILLILLCIATVFLSVGGTALY

Method	From	To	amino acid sequence
SOSUI	658	680	SCILLILLCIATVFLSVGGTALY

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2270 bp
Genome contig ID	gi65488608f_179400649
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAAATCAAGCTTGTAATTTAAAATCTACACCAAC
Flanking genome sequence (181074 - 181123)	----+--------+--------+--------+--------+----* AAAATGTCTCCGAGAATTTATTTGAACCCTTTGGGTGTTGGGGGACGTGC

Gene/Protein Characteristic Table for mFLJ00215

Features of the cloned DNA sequence

Features of the protein sequence