ROUGE

Gene/Protein Characteristic Table for mFLJ00213

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131158
Description :	transforming growth factor beta regulated gene 1.
Clone Name :	mfj05239 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3769 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3066 bp

Genome contig ID gi65519420r_37490690
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GTTGCTTGTACTTTCAGTAATAAATATATCCTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTCGGTTATTTGTTTCTTCTTGTAGTCGGGATATGATCATTTTTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00213 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00213	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..535, 3294..3599
Length: 279 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21408	1.1e-105	100.0	mFLJ00213 prote...	Mus musculus
EDL25439	5.5e-60	100.0	transforming gr...	Mus musculus
BAB27734	2e-48	100.0	unnamed protein...	Mus musculus
BAE38845	4.3e-48	59.9	unnamed protein...	Mus musculus
BAE30090	4.3e-48	60.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3066 bp
Genome contig ID	gi65519420r_37490690
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GTTGCTTGTACTTTCAGTAATAAATATATCCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTCGGTTATTTGTTTCTTCTTGTAGTCGGGATATGATCATTTTTGTT

Gene/Protein Characteristic Table for mFLJ00213

Features of the cloned DNA sequence

Features of the protein sequence