ROUGE |
Gene/Protein Characteristic Table for mFLJ00199 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131152 |
---|---|
mbg01512 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5121 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2420 bp Genome contig ID gi66880554f_30201085 PolyA signal sequence
(GATAAA,-19) +----*----+----*----+----*----+----
TAAGGCCTGTGAGTCAGATAAAGGACCGAAGCGACFlanking genome sequence
(116599 - 116648) ----+----*----+----*----+----*----+----*----+----*
TCTTCTCTGTGTCTTGCTGGGTAGAGGTGGGGGCAATGCTGAGCCAAAGG
KIAA Alignment based on: FLJ00199 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1215..1622, 1913..2596, 3486..3737
Length: 447 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |