ROUGE

Gene/Protein Characteristic Table for mFLJ00199

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131152
Description :
Clone Name :	mbg01512 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5121 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2420 bp

Genome contig ID gi66880554f_30201085
PolyA signal sequence
(GATAAA,-19)
+----*----+----*----+----*----+----
TAAGGCCTGTGAGTCAGATAAAGGACCGAAGCGAC
Flanking genome sequence
(116599 - 116648)
----+----*----+----*----+----*----+----*----+----*
TCTTCTCTGTGTCTTGCTGGGTAGAGGTGGGGGCAATGCTGAGCCAAAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00199 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00199	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1215..1622, 1913..2596, 3486..3737
Length: 447 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21402	7.4e-187	100.0	mFLJ00199 prote...	Mus musculus
Q8BK03	2.7e-105	69.8	Protein FAM73B.	Mus musculus
BAE32434	2.9e-105	69.8	unnamed protein...	Mus musculus
EDL08464	3e-105	69.8	RIKEN cDNA 5730...	Mus musculus
EDL93315	1.9e-103	70.1	similar to CG12...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 56 107 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	56	107	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2420 bp
Genome contig ID	gi66880554f_30201085
PolyA signal sequence (GATAAA,-19)	+--------+--------+----*----+---- TAAGGCCTGTGAGTCAGATAAAGGACCGAAGCGAC
Flanking genome sequence (116599 - 116648)	----+--------+--------+--------+--------+----* TCTTCTCTGTGTCTTGCTGGGTAGAGGTGGGGGCAATGCTGAGCCAAAGG

Gene/Protein Characteristic Table for mFLJ00199

Features of the cloned DNA sequence

Features of the protein sequence