ROUGE

Gene/Protein Characteristic Table for mFLJ00197

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220309
Description :	sex comb on midleg-like 4. sex comb on midleg-like.
Clone Name :	mfj37062 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4129 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3038 bp

Genome contig ID gi65524842f_42930413
PolyA signal sequence
(AATAAA,-14)
+----*----+----*----+----*----+----
ACAGTGTACCCAAATATAATAAATAAATCTTAAGG
Flanking genome sequence
(136732 - 136781)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAGTCGCCACTTTCTGAAACCAGATCACTATGTTTATAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00197 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00197	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1091
Length: 362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90230	9.2e-136	100.0	mFLJ00197 prote...	Mus musculus
Q80VG1	1e-135	100.0	Sex comb on mid...	Mus musculus
AAH43310	1e-135	100.0	Sex comb on mid...	Mus musculus
BAE20663	5.2e-131	100.0	unnamed protein...	Mus musculus
XP_539072	2.5e-108	79.9	similar to sex ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220408	1.8e-05	40.2	mKIAA1617

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011510 291 360 PF07647 Sterile alpha motif homology 2

IPR001660 292 358 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 291 360 SM00454 Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	291	360	PF07647	Sterile alpha motif homology 2
IPR001660	292	358	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	291	360	SM00454	Sterile alpha motif SAM

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3038 bp
Genome contig ID	gi65524842f_42930413
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- ACAGTGTACCCAAATATAATAAATAAATCTTAAGG
Flanking genome sequence (136732 - 136781)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAGTCGCCACTTTCTGAAACCAGATCACTATGTTTATAA

Gene/Protein Characteristic Table for mFLJ00197

Features of the cloned DNA sequence

Features of the protein sequence