ROUGE

Gene/Protein Characteristic Table for mFLJ00190

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AY184376
Description :	interleukin 28 receptor alpha. class II cytokine receptor 12. interferon-lambda receptor 1.
Clone Name :	msp01054 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 1585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65493515f_134471778
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGGGCCGGATGCTGGGAGATTACTTGGTCAGGTGA
Flanking genome sequence
(115344 - 115393)
----+----*----+----*----+----*----+----*----+----*
GCTGGCCCTGGTGGTCCATCTACACATTCTCTACTGCACTTCCCCTGGAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00190 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00190	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1585
Length: 527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8CGK5	1.7e-206	100.0	Interleukin-28 ...	Mus musculus
AAH57856	3.4e-205	99.4	Interleukin 28 ...	Mus musculus
XP_342947	3e-154	79.9	similar to Inte...	Rattus norvegicus
Q8IU57	1.5e-106	59.7	Interleukin-28 ...	Homo sapiens
BAD18707	1.5e-106	59.7	FLJ00190 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000282 19 114 PS50299 Cytokine receptor class 2

NULL 474 497 PS50313 NULL

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000282	19	114	PS50299	Cytokine receptor class 2
NULL	474	497	PS50313	NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 219 241 AVLAMPSLLLLLIAAVAAGVAWK

Method	From	To	amino acid sequence
SOSUI	219	241	AVLAMPSLLLLLIAAVAAGVAWK

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi65493515f_134471778
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGGCCGGATGCTGGGAGATTACTTGGTCAGGTGA
Flanking genome sequence (115344 - 115393)	----+--------+--------+--------+--------+----* GCTGGCCCTGGTGGTCCATCTACACATTCTCTACTGCACTTCCCCTGGAC

Gene/Protein Characteristic Table for mFLJ00190

Features of the cloned DNA sequence

Features of the protein sequence