Gene/Protein Characteristic Table for mFLJ00189

Length: 4991 bp

Restriction map

Length of 3'UTR	2859 bp
Genome contig ID	gi65519420f_110821473
PolyA signal sequence (AATAAA,-21)	+----*----+----*----+----*----+---- TATTCAGGATTTTTAATAAACCCATTTTCATCTTT
Flanking genome sequence (120356 - 120405)	----+----*----+----*----+----*----+----*----+----* ATTTGTGTGCATGTGTGTTCATGTGTGTGTTGGCATGTGTGTGTTTGCAC

KIAA	Alignment based on:
FLJ00189	DNA sequence, AA sequence, Physical map

Coding region: 129..2126, 2339..2956

Length: 871 aa

Entry Exp ID% Protein Source BAD21399 0 100.0 mFLJ00189 prote... Mus musculus Q60I26 0 89.2 ALS2 C-terminal... Mus musculus AAM89221 0 88.8 RN49018 [Mus mu... Mus musculus XP_236654 0 83.4 similar to Als2... Rattus norvegicus EDL08987 0 85.5 ALS2 C-terminal... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AB053307 8.1e-58 29.9 mKIAA1563

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003409	380	402	PF02493	MORN motif
	IPR003409	403	425	PF02493	MORN motif
	IPR003409	431	453	PF02493	MORN motif
	IPR003409	454	476	PF02493	MORN motif
	IPR003409	481	503	PF02493	MORN motif
	IPR003409	505	527	PF02493	MORN motif
	IPR003409	528	550	PF02493	MORN motif
	IPR003409	551	574	PF02493	MORN motif
	IPR003123	752	856	PF02204	Vacuolar sorting protein 9

Method	From	To	amino acid sequence
-	-	-	-