ROUGE |
Gene/Protein Characteristic Table for mFLJ00189 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131149 |
---|---|
mbg21569 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4991 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2859 bp Genome contig ID gi65519420f_110821473 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TATTCAGGATTTTTAATAAACCCATTTTCATCTTTFlanking genome sequence
(120356 - 120405) ----+----*----+----*----+----*----+----*----+----*
ATTTGTGTGCATGTGTGTTCATGTGTGTGTTGGCATGTGTGTGTTTGCAC
KIAA Alignment based on: FLJ00189 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 129..2126, 2339..2956
Length: 871 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |