| ROUGE |
Gene/Protein Characteristic Table for mFLJ00183 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK048244 |
|---|---|
| cyclin L2 isoform 1. Paneth cell enhanced expression. |
|
| mpm03276 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4011 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 658 bp Genome contig ID gi65493515f_154204944 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
GGTTGAATAAACAATTCTCAGGACACTTGTTATGTFlanking genome sequence
(111776 - 111825) ----+----*----+----*----+----*----+----*----+----*
AAGACTTTGTGGGCTGTCATTCTGGTTGTTTCTTTGAGTGTATGCCTGGG
KIAA Alignment based on: FLJ00183 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..678, 2781..3353
Length: 416 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |