ROUGE

Gene/Protein Characteristic Table for mFLJ00177

Link to : NEDO \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220239
Description :	Trpc4-associated protein.
Clone Name :	mid10035 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3165 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 717 bp

Genome contig ID gi66880554r_154991224
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CCGATTAAATGGAGACTATTAAAGAACTTTATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGACTGATGTGGACCTGACTTTGTCCATGATGTTCTGTTCCCAGCTCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00177 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00177	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2448
Length: 815 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD90164	100.0	mFLJ00177 prote...	Mus musculus
Q9JLV2	100.0	Trpc4-associate...	Mus musculus
AAM46938	99.7	TNF-receptor ub...	Mus musculus
EDL85903	99.0	transient recep...	Rattus norvegicus
AAH87662	99.0	Trpc4ap protein...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	717 bp
Genome contig ID	gi66880554r_154991224
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CCGATTAAATGGAGACTATTAAAGAACTTTATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGACTGATGTGGACCTGACTTTGTCCATGATGTTCTGTTCCCAGCTCC

Gene/Protein Characteristic Table for mFLJ00177

Features of the cloned DNA sequence

Features of the protein sequence