ROUGE |
Gene/Protein Characteristic Table for mFLJ00169 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB035383 |
---|---|
ADP-ribosylation factor-like 6 interacting protein 4. ADP-ribosylation-like factor 6 interacting protein 4. SRp25 nuclear protein. |
|
mbk00979 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1181 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 154 bp Genome contig ID gi65498774f_123187435 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
AGCAGAGTGTCACTATTAAATGATCTTGGTCACAGFlanking genome sequence
(102088 - 102137) ----+----*----+----*----+----*----+----*----+----*
AGTTCCTGTTGTGTTGCATTTTGTGCTGAGGAGTGGAACTGTTGCCATTT
KIAA Alignment based on: FLJ00169 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 326..1027
Length: 233 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |