ROUGE

Gene/Protein Characteristic Table for mFLJ00169

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB035383
Description :	ADP-ribosylation factor-like 6 interacting protein 4. ADP-ribosylation-like factor 6 interacting protein 4. SRp25 nuclear protein.
Clone Name :	mbk00979 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1181 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 154 bp

Genome contig ID gi65498774f_123187435
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
AGCAGAGTGTCACTATTAAATGATCTTGGTCACAG
Flanking genome sequence
(102088 - 102137)
----+----*----+----*----+----*----+----*----+----*
AGTTCCTGTTGTGTTGCATTTTGTGCTGAGGAGTGGAACTGTTGCCATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00169 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00169	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 326..1027
Length: 233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9JM93	1.5e-62	100.0	ADP-ribosylatio...	Mus musculus
Q4V8I5	7.2e-57	90.5	ADP-ribosylatio...	Rattus norvegicus
XP_001479748	3e-56	92.6	similar to SRp2...	Mus musculus
EDM13603	2.5e-51	90.2	ADP-ribosylatio...	Rattus norvegicus
XP_001168883	1e-49	82.9	similar to ARL6...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 10 91 PS50324 NULL

IPR001472 94 111 PS50079 Bipartite nuclear localization signal

NULL 95 123 PS50318 NULL

IPR001472 96 113 PS50079 Bipartite nuclear localization signal

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	10	91	PS50324	NULL
IPR001472	94	111	PS50079	Bipartite nuclear localization signal
NULL	95	123	PS50318	NULL
IPR001472	96	113	PS50079	Bipartite nuclear localization signal

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	154 bp
Genome contig ID	gi65498774f_123187435
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AGCAGAGTGTCACTATTAAATGATCTTGGTCACAG
Flanking genome sequence (102088 - 102137)	----+--------+--------+--------+--------+----* AGTTCCTGTTGTGTTGCATTTTGTGCTGAGGAGTGGAACTGTTGCCATTT

Gene/Protein Characteristic Table for mFLJ00169

Features of the cloned DNA sequence

Features of the protein sequence