ROUGE

Gene/Protein Characteristic Table for mFLJ00116

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220305
Description :
Clone Name :	mfj13146 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4208 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2841 bp

Genome contig ID gi65532617f_108532585
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
CAGTGTACTTACATATATTAATAAAATAAATCTTT
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00116 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00116	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 498..1367
Length: 289 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90229	2e-113	100.0	mFLJ00116 prote...	Mus musculus
AAH22617	6.8e-111	100.0	4930427A07Rik p...	Mus musculus
Q3UK37	3.2e-109	99.6	Uncharacterized...	Mus musculus
EDL18556	4.3e-109	99.3	RIKEN cDNA 4930...	Mus musculus
BAE39248	1.7e-107	97.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2841 bp
Genome contig ID	gi65532617f_108532585
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- CAGTGTACTTACATATATTAATAAAATAAATCTTT
Flanking genome sequence	None

Gene/Protein Characteristic Table for mFLJ00116

Features of the cloned DNA sequence

Features of the protein sequence