| ROUGE |
Gene/Protein Characteristic Table for mFLJ00107 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK131130 |
|---|---|
| zinc finger protein 521. ecotropic viral integration site 3. |
|
| mfj24090 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5034 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 779 bp Genome contig ID gi65551972r_13776627 PolyA signal sequence
(AATAAA,-20)
TGTTTTCCAAGAGGAAATAAATTCAGTTTACCATCFlanking genome sequence
(100000 - 99951)
AGCTGTGAGTGTATTTGTGTGTTTTCCTTTTCTAGTTAGTCTTACCATTA
KIAA Alignment based on: FLJ00107 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 140..4255
Length: 1371 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
