ROUGE

Gene/Protein Characteristic Table for mFLJ00095

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK032373
Description :	DnaJ homolog subfamily C member 5.
Clone Name :	mfj57291 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2854 bp

Genome contig ID gi66880554f_181137533
PolyA signal sequence
(AAGAAA,-18)
+----*----+----*----+----*----+----
AGCCAGGACTACACACAAAGAAATCCTGTCTTAAG
Flanking genome sequence
(131657 - 131706)
----+----*----+----*----+----*----+----*----+----*
AAGAAAAAAAAAACAAAGCAAAACAAAACAAAACAAAAGAAAAAAGCCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00095 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00095	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 129..731
Length: 200 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P60905	8e-85	100.0	DnaJ homolog su...	Rattus norvegicus
Q9H3Z4	2e-84	99.5	DnaJ homolog su...	Homo sapiens
Q29455	5.1e-84	98.5	DnaJ homolog su...	Bos taurus
AAH12268	8.3e-84	99.0	Dnajc5 protein ...	Mus musculus
2108343A	1.3e-82	97.0	Cys string protein.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122407	9.6e-10	48.1	mKIAA0962

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001623 17 82 PF00226 Heat shock protein DnaJ

HMMSmart IPR001623 16 74 SM00271 Heat shock protein DnaJ

ProfileScan IPR001623 17 82 PS50076 Heat shock protein DnaJ

NULL 115 138 PS50311 NULL

ScanRegExp IPR001623 59 78 PS00636 Heat shock protein DnaJ

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001623	17	82	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	16	74	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	17	82	PS50076	Heat shock protein DnaJ
NULL	115	138	PS50311	NULL
ScanRegExp	IPR001623	59	78	PS00636	Heat shock protein DnaJ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 106 128 WWAKALFVVCGLLTCCYCCCCLC

Method	From	To	amino acid sequence
SOSUI	106	128	WWAKALFVVCGLLTCCYCCCCLC

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2854 bp
Genome contig ID	gi66880554f_181137533
PolyA signal sequence (AAGAAA,-18)	+--------+--------+----*----+---- AGCCAGGACTACACACAAAGAAATCCTGTCTTAAG
Flanking genome sequence (131657 - 131706)	----+--------+--------+--------+--------+----* AAGAAAAAAAAAACAAAGCAAAACAAAACAAAACAAAAGAAAAAAGCCAG

Gene/Protein Characteristic Table for mFLJ00095

Features of the cloned DNA sequence

Features of the protein sequence