ROUGE |
Gene/Protein Characteristic Table for mFLJ00070 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131126 |
---|---|
Latent transforming growth factor beta binding protein 3 precursor. | |
mbg01449 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5729 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 439 bp Genome contig ID gi65553144f_5432694 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TGGTTTGTACAATAAATACATCCGCCGGGCCTGCTFlanking genome sequence
(114630 - 114679) ----+----*----+----*----+----*----+----*----+----*
CTCCAGTGGTTGGAAGCCCAGTGGCTTGGGGGTGGGGTTGTCAGTCCAGC
KIAA Alignment based on: FLJ00070 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1474..1866, 2015..2422, 2588..5290
Length: 1167 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |