ROUGE

Gene/Protein Characteristic Table for mFLJ00070

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131126
Description :	Latent transforming growth factor beta binding protein 3 precursor.
Clone Name :	mbg01449 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5729 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 439 bp

Genome contig ID gi65553144f_5432694
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGGTTTGTACAATAAATACATCCGCCGGGCCTGCT
Flanking genome sequence
(114630 - 114679)
----+----*----+----*----+----*----+----*----+----*
CTCCAGTGGTTGGAAGCCCAGTGGCTTGGGGGTGGGGTTGTCAGTCCAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00070 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00070	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1474..1866, 2015..2422, 2588..5290
Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21376	100.0	mFLJ00070 prote...	Mus musculus
AAI68401	98.4	Latent transfor...	synthetic construct
AAF62352	93.5	latent transfor...	Homo sapiens
EAW74403	94.6	latent transfor...	Homo sapiens
XP_611940	92.5	similar to late...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220196	7e-29	33.0	mKIAA4226
AK122376	7.7e-06	24.6	mKIAA0813
AK173032	2.7e-05	26.3	mKIAA0815
AK122555	4.5e-05	23.7	mKIAA1781
AK122378	4.6e-05	23.9	mKIAA0818

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001438 527 538 PR00010 Type II EGF-like signature

IPR001438 650 657 PR00010 Type II EGF-like signature

IPR001438 675 685 PR00010 Type II EGF-like signature

HMMPfam IPR006209 24 51 PF00008 EGF-like

IPR002212 198 241 PF00683 Matrix fibril-associated

IPR001881 268 305 PF07645 EGF-like calcium-binding

IPR002212 324 365 PF00683 Matrix fibril-associated

IPR006209 489 525 PF00008 EGF-like

IPR001881 527 569 PF07645 EGF-like calcium-binding

IPR001881 571 603 PF07645 EGF-like calcium-binding

IPR001881 614 653 PF07645 EGF-like calcium-binding

IPR001881 655 694 PF07645 EGF-like calcium-binding

IPR006209 659 694 PF00008 EGF-like

IPR001881 696 735 PF07645 EGF-like calcium-binding

IPR006209 700 735 PF00008 EGF-like

IPR001881 737 775 PF07645 EGF-like calcium-binding

IPR001881 777 818 PF07645 EGF-like calcium-binding

IPR006209 781 818 PF00008 EGF-like

IPR002212 838 881 PF00683 Matrix fibril-associated

IPR001881 904 945 PF07645 EGF-like calcium-binding

IPR001881 947 986 PF07645 EGF-like calcium-binding

IPR006209 951 986 PF00008 EGF-like

IPR002212 1010 1055 PF00683 Matrix fibril-associated

IPR001881 1118 1161 PF07645 EGF-like calcium-binding

HMMSmart IPR006210 23 52 SM00181 Type I EGF

IPR001881 24 52 SM00179 EGF-like calcium-binding

IPR001881 266 306 SM00179 EGF-like calcium-binding

IPR006210 269 306 SM00181 Type I EGF

IPR001881 485 526 SM00179 EGF-like calcium-binding

IPR006210 488 526 SM00181 Type I EGF

IPR001881 527 570 SM00179 EGF-like calcium-binding

IPR006210 530 570 SM00181 Type I EGF

IPR001881 571 613 SM00179 EGF-like calcium-binding

IPR006210 574 613 SM00181 Type I EGF

IPR001881 614 654 SM00179 EGF-like calcium-binding

IPR006210 617 654 SM00181 Type I EGF

IPR001881 655 695 SM00179 EGF-like calcium-binding

IPR006210 658 695 SM00181 Type I EGF

IPR001881 696 736 SM00179 EGF-like calcium-binding

IPR006210 699 736 SM00181 Type I EGF

IPR001881 737 776 SM00179 EGF-like calcium-binding

IPR006210 740 776 SM00181 Type I EGF

IPR001881 777 819 SM00179 EGF-like calcium-binding

IPR006210 780 819 SM00181 Type I EGF

IPR001881 904 946 SM00179 EGF-like calcium-binding

IPR006210 907 946 SM00181 Type I EGF

IPR001881 947 987 SM00179 EGF-like calcium-binding

IPR006210 950 987 SM00181 Type I EGF

IPR001881 1081 1117 SM00179 EGF-like calcium-binding

IPR006210 1084 1117 SM00181 Type I EGF

IPR001881 1118 1162 SM00179 EGF-like calcium-binding

IPR006210 1121 1162 SM00181 Type I EGF

ProfileScan IPR000694 105 206 PS50099 Proline-rich region

NULL 266 306 PS50034 NULL

IPR000694 395 471 PS50099 Proline-rich region

NULL 485 526 PS50034 NULL

NULL 489 805 PS50311 NULL

NULL 527 570 PS50034 NULL

NULL 571 613 PS50034 NULL

NULL 614 654 PS50034 NULL

NULL 655 695 PS50034 NULL

NULL 696 736 PS50034 NULL

NULL 737 776 PS50034 NULL

NULL 777 819 PS50034 NULL

NULL 904 946 PS50034 NULL

NULL 947 987 PS50034 NULL

NULL 1118 1162 PS50034 NULL

ScanRegExp IPR006209 40 51 PS00022 EGF-like

IPR000152 281 292 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 510 525 PS01186 EGF-like

IPR001881 527 552 PS01187 EGF-like calcium-binding

IPR000152 543 554 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 571 596 PS01187 EGF-like calcium-binding

IPR000152 587 598 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 614 638 PS01187 EGF-like calcium-binding

IPR001881 655 679 PS01187 EGF-like calcium-binding

IPR000152 670 681 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 679 694 PS01186 EGF-like

IPR001881 696 720 PS01187 EGF-like calcium-binding

IPR000152 711 722 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 720 735 PS01186 EGF-like

IPR001881 737 761 PS01187 EGF-like calcium-binding

IPR000152 752 763 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 777 803 PS01187 EGF-like calcium-binding

IPR000152 794 805 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 803 818 PS01186 EGF-like

IPR001881 904 930 PS01187 EGF-like calcium-binding

IPR000152 921 932 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 930 945 PS01186 EGF-like

IPR001881 947 971 PS01187 EGF-like calcium-binding

IPR000152 962 973 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1101 1116 PS01186 EGF-like

IPR001881 1118 1146 PS01187 EGF-like calcium-binding

IPR000152 1137 1148 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1146 1161 PS01186 EGF-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001438	527	538	PR00010	Type II EGF-like signature
IPR001438	650	657	PR00010	Type II EGF-like signature
IPR001438	675	685	PR00010	Type II EGF-like signature
HMMPfam	IPR006209	24	51	PF00008	EGF-like
IPR002212	198	241	PF00683	Matrix fibril-associated
IPR001881	268	305	PF07645	EGF-like calcium-binding
IPR002212	324	365	PF00683	Matrix fibril-associated
IPR006209	489	525	PF00008	EGF-like
IPR001881	527	569	PF07645	EGF-like calcium-binding
IPR001881	571	603	PF07645	EGF-like calcium-binding
IPR001881	614	653	PF07645	EGF-like calcium-binding
IPR001881	655	694	PF07645	EGF-like calcium-binding
IPR006209	659	694	PF00008	EGF-like
IPR001881	696	735	PF07645	EGF-like calcium-binding
IPR006209	700	735	PF00008	EGF-like
IPR001881	737	775	PF07645	EGF-like calcium-binding
IPR001881	777	818	PF07645	EGF-like calcium-binding
IPR006209	781	818	PF00008	EGF-like
IPR002212	838	881	PF00683	Matrix fibril-associated
IPR001881	904	945	PF07645	EGF-like calcium-binding
IPR001881	947	986	PF07645	EGF-like calcium-binding
IPR006209	951	986	PF00008	EGF-like
IPR002212	1010	1055	PF00683	Matrix fibril-associated
IPR001881	1118	1161	PF07645	EGF-like calcium-binding
HMMSmart	IPR006210	23	52	SM00181	Type I EGF
IPR001881	24	52	SM00179	EGF-like calcium-binding
IPR001881	266	306	SM00179	EGF-like calcium-binding
IPR006210	269	306	SM00181	Type I EGF
IPR001881	485	526	SM00179	EGF-like calcium-binding
IPR006210	488	526	SM00181	Type I EGF
IPR001881	527	570	SM00179	EGF-like calcium-binding
IPR006210	530	570	SM00181	Type I EGF
IPR001881	571	613	SM00179	EGF-like calcium-binding
IPR006210	574	613	SM00181	Type I EGF
IPR001881	614	654	SM00179	EGF-like calcium-binding
IPR006210	617	654	SM00181	Type I EGF
IPR001881	655	695	SM00179	EGF-like calcium-binding
IPR006210	658	695	SM00181	Type I EGF
IPR001881	696	736	SM00179	EGF-like calcium-binding
IPR006210	699	736	SM00181	Type I EGF
IPR001881	737	776	SM00179	EGF-like calcium-binding
IPR006210	740	776	SM00181	Type I EGF
IPR001881	777	819	SM00179	EGF-like calcium-binding
IPR006210	780	819	SM00181	Type I EGF
IPR001881	904	946	SM00179	EGF-like calcium-binding
IPR006210	907	946	SM00181	Type I EGF
IPR001881	947	987	SM00179	EGF-like calcium-binding
IPR006210	950	987	SM00181	Type I EGF
IPR001881	1081	1117	SM00179	EGF-like calcium-binding
IPR006210	1084	1117	SM00181	Type I EGF
IPR001881	1118	1162	SM00179	EGF-like calcium-binding
IPR006210	1121	1162	SM00181	Type I EGF
ProfileScan	IPR000694	105	206	PS50099	Proline-rich region
NULL	266	306	PS50034	NULL
IPR000694	395	471	PS50099	Proline-rich region
NULL	485	526	PS50034	NULL
NULL	489	805	PS50311	NULL
NULL	527	570	PS50034	NULL
NULL	571	613	PS50034	NULL
NULL	614	654	PS50034	NULL
NULL	655	695	PS50034	NULL
NULL	696	736	PS50034	NULL
NULL	737	776	PS50034	NULL
NULL	777	819	PS50034	NULL
NULL	904	946	PS50034	NULL
NULL	947	987	PS50034	NULL
NULL	1118	1162	PS50034	NULL
ScanRegExp	IPR006209	40	51	PS00022	EGF-like
IPR000152	281	292	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	510	525	PS01186	EGF-like
IPR001881	527	552	PS01187	EGF-like calcium-binding
IPR000152	543	554	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	571	596	PS01187	EGF-like calcium-binding
IPR000152	587	598	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	614	638	PS01187	EGF-like calcium-binding
IPR001881	655	679	PS01187	EGF-like calcium-binding
IPR000152	670	681	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	679	694	PS01186	EGF-like
IPR001881	696	720	PS01187	EGF-like calcium-binding
IPR000152	711	722	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	720	735	PS01186	EGF-like
IPR001881	737	761	PS01187	EGF-like calcium-binding
IPR000152	752	763	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	777	803	PS01187	EGF-like calcium-binding
IPR000152	794	805	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	803	818	PS01186	EGF-like
IPR001881	904	930	PS01187	EGF-like calcium-binding
IPR000152	921	932	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	930	945	PS01186	EGF-like
IPR001881	947	971	PS01187	EGF-like calcium-binding
IPR000152	962	973	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1101	1116	PS01186	EGF-like
IPR001881	1118	1146	PS01187	EGF-like calcium-binding
IPR000152	1137	1148	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1146	1161	PS01186	EGF-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	439 bp
Genome contig ID	gi65553144f_5432694
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGGTTTGTACAATAAATACATCCGCCGGGCCTGCT
Flanking genome sequence (114630 - 114679)	----+--------+--------+--------+--------+----* CTCCAGTGGTTGGAAGCCCAGTGGCTTGGGGGTGGGGTTGTCAGTCCAGC

Gene/Protein Characteristic Table for mFLJ00070

Features of the cloned DNA sequence

Features of the protein sequence