Gene/Protein Characteristic Table for mFLJ00067

Length: 3275 bp

Restriction map

Length of 3'UTR	598 bp
Genome contig ID	gi65527427r_115783190
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- GAGAAAATAAAAATAAAACATTATCCACTGCCCTC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGAAAAATCTATAGTTGGCTTACAGTGGGTCCAGGAAGATCTGTCAGGCC

KIAA	Alignment based on:
FLJ00067	DNA sequence, AA sequence, Physical map

Coding region: 2..2677

Length: 891 aa

Entry Exp ID% Protein Source BAD90124 0 100.0 mFLJ00067 prote... Mus musculus AAI41290 0 100.0 Unc-13 homolog ... Mus musculus CAM24043 0 99.8 unc-13 homolog ... Mus musculus EDM06641 0 94.7 unc-13 homolog ... Rattus norvegicus Q9R189 0 94.1 Protein unc-13 ... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122358 1.5e-58 32.7 mKIAA0734 AK220537 4.7e-08 32.8 mKIAA4194 AK220264 2.4e-06 32.3 mKIAA1342 AK122200 8.5e-06 35.0 mKIAA0080 AK220532 3.1e-05 35.5 mKIAA4186

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	747	759	PR00360	C2
	IPR000008	778	791	PR00360	C2
HMMPfam	IPR010439	262	334	PF06292	Protein of unknown function DUF1041
	IPR000008	732	824	PF00168	C2
HMMSmart	IPR000008	731	839	SM00239	C2
ProfileScan	IPR000008	731	824	PS50004	C2

Method	From	To	amino acid sequence
-	-	-	-