ROUGE

Gene/Protein Characteristic Table for mFLJ00052

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK045475
Description :
Clone Name :	mpj02918 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1591 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 496 bp

Genome contig ID gi65498774r_116121218
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCACTTTCTTGGAGAAATAAATGATATAGAACATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATCTGCCTTGGGCTTCTACTCCAATGACTGCGTGAGTGTCTTCACCCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00052 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00052	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1095
Length: 364 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_341093	1.7e-93	92.6	similar to Sin3...	Rattus norvegicus
Q8BR65	2.7e-92	100.0	Sin3 histone de...	Mus musculus
XP_001084823	4.4e-92	90.5	similar to Sin3...	Macaca mulatta
BAC31608	5.2e-92	99.7	unnamed protein...	Mus musculus
BAB15750	7.8e-92	91.0	FLJ00052 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	496 bp
Genome contig ID	gi65498774r_116121218
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCACTTTCTTGGAGAAATAAATGATATAGAACATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATCTGCCTTGGGCTTCTACTCCAATGACTGCGTGAGTGTCTTCACCCTG

Gene/Protein Characteristic Table for mFLJ00052

Features of the cloned DNA sequence

Features of the protein sequence