ROUGE |
Gene/Protein Characteristic Table for mFLJ00043 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AF305089 |
---|---|
tangerin. | |
msk06005 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1575 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 277 bp Genome contig ID gi65553144r_5396843 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CTCTTCTGGAGGGAGCAATAAAGTTGGAGTAGAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACCAGCGCCTGCCCTTTCTCAACAGGGCCTCAATGGAAGGAAGAGGGT
KIAA Alignment based on: FLJ00043 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1298
Length: 431 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |