ROUGE

Gene/Protein Characteristic Table for mFLJ00023

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131114
Description :	Mitochondrial 28S ribosomal protein S25.
Clone Name :	mbg19413 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5992 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5497 bp

Genome contig ID gi65504368r_92516961
PolyA signal sequence
(AATACA,-11)
+----*----+----*----+----*----+----
TCCAGAGCTTTTGTCTTAATTTTGAATACATACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGCTTTAAGCTGGCAAAATTATGTCCTTTCCATCATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00023 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00023	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..495
Length: 164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21364	3.2e-64	100.0	mFLJ00023 prote...	Mus musculus
Q9D125	3.3e-64	100.0	28S ribosomal p...	Mus musculus
BAB28705	1.7e-63	99.4	unnamed protein...	Mus musculus
Q4QR80	1.7e-61	95.1	28S ribosomal p...	Rattus norvegicus
XP_001491213	1.6e-57	89.5	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5497 bp
Genome contig ID	gi65504368r_92516961
PolyA signal sequence (AATACA,-11)	+--------+--------+----*----+---- TCCAGAGCTTTTGTCTTAATTTTGAATACATACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGCTTTAAGCTGGCAAAATTATGTCCTTTCCATCATTT

Gene/Protein Characteristic Table for mFLJ00023

Features of the cloned DNA sequence

Features of the protein sequence