ROUGE |
Gene/Protein Characteristic Table for mFLJ00002 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131108 |
---|---|
ATP-binding cassette, sub-family C, member 10 isoform mrp7A. multidrug resistance-associated protein 7. |
|
mbg13511 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5652 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1886 bp Genome contig ID gi65550231r_43712913 PolyA signal sequence
(GATAAA,-19) +----*----+----*----+----*----+----
TTTCATAATTTTATTTGATAAAATTCCTATCTTACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTCTGTGTTTTAAAAAAATACTATTTCTGGTGTGAGGCAGAAATCCCCT
KIAA Alignment based on: FLJ00002 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1384, 1498..2241, 2297..3733, 4497..5393
Length: 1486 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |