HUGE

Gene/Protein Characteristic Table for KIAA2037

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05838
Accession No. :	AB111889
Description :	lin-54 homolog.
HUGO Gene Name :
Clone Name :	pj01545 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4506 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2553 bp

Genome contig ID gi89161207r_83965725
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
GCTCAGTTATTACTAACATAAATTGCTTTGAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAATATGTCTTCTCTTTTTTTCCCCACTGTTTCTTTTAAGAGCAGAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 84065725 84150998 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 494 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5RBN8	3e-163	100.0	Protein lin-54 ...	Pongo abelii
CAD97902	3.3e-163	100.0	hypothetical pr...	Homo sapiens
Q6MZP7	3.8e-163	100.0	Protein lin-54 ...	Homo sapiens
EAX05917	3.8e-163	100.0	hypothetical pr...	Homo sapiens
ACE86510	1.3e-162	99.8	lin-54 homolog ...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005172 265 305 PF03638 Tesmin/TSO1-like

IPR005172 339 380 PF03638 Tesmin/TSO1-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005172	265	305	PF03638	Tesmin/TSO1-like
IPR005172	339	380	PF03638	Tesmin/TSO1-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2553 bp
Genome contig ID	gi89161207r_83965725
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- GCTCAGTTATTACTAACATAAATTGCTTTGAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAATATGTCTTCTCTTTTTTTCCCCACTGTTTCTTTTAAGAGCAGAAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	84065725	84150998	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA2037

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information