HUGE

Gene/Protein Characteristic Table for KIAA2030

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05749
Accession No. :	AB107352
Description :
HUGO Gene Name :	ubinuclein 2 (UBN2)
Clone Name :	ef00583 [Vector Info]
Source :

Features of the cloned DNA sequence	Description

Length: 7921 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4849 bp

Genome contig ID gi89161213f_138496605
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCTC
Flanking genome sequence
(141367 - 141416)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAATAAAAGTATAGAAAAGTATCTTTTCACAAGAGGCCACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 138596605 138637970 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC86361	100.0	unnamed protein...	Homo sapiens
EAL24038	100.0	hypothetical pr...	Homo sapiens
XP_001150254	99.7	hypothetical pr...	Pan troglodytes
XP_001150331	99.7	hypothetical pr...	Pan troglodytes
XP_001108123	98.4	similar to Ubin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR000217 865 871 PS00227 Tubulin

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000217	865	871	PS00227	Tubulin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4849 bp
Genome contig ID	gi89161213f_138496605
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCTC
Flanking genome sequence (141367 - 141416)	----+--------+--------+--------+--------+----* AAAAAAAGAAAATAAAAGTATAGAAAAGTATCTTTTCACAAGAGGCCACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	138596605	138637970	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA2030

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information