HUGE

Gene/Protein Characteristic Table for KIAA2000

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06179
Accession No. :	AB082531
Description :	Nephrocystin-3.
HUGO Gene Name :	nephronophthisis 3 (adolescent) (NPHP3)
Clone Name :	bf00135 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7784 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3704 bp

Genome contig ID gi89161205r_133659676
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TGAACATTAGGAATTAAAGGCTATATCTGGTCCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAATTTTGTAATTTGTTTCTCTGTCTGAGGAAAGCTGGCTGGATTGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 133759676 133923993 45 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW79187	99.9	nephronophthisi...	Homo sapiens
Q7Z494	99.9	Nephrocystin-3.	Homo sapiens
XP_516758	99.0	nephronophthisi...	Pan troglodytes
XP_001115440	97.9	similar to neph...	Macaca mulatta
XP_001495737	94.7	nephronophthisi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014564	5.7e-08	23.8	KIAA0664
AB058688	5.6e-05	26.4	KIAA1785
AB028966	5.8e-05	24.2	KIAA1043
D86981	0.0003	25.2	KIAA0228

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002151 428 447 PR00381 Kinesin light chain

IPR002151 450 468 PR00381 Kinesin light chain

IPR002151 515 532 PR00381 Kinesin light chain

IPR002151 559 579 PR00381 Kinesin light chain

IPR002151 594 615 PR00381 Kinesin light chain

HMMPfam IPR001440 285 318 PF00515 Tetratricopeptide TPR_1

IPR001440 327 360 PF00515 Tetratricopeptide TPR_1

IPR001440 369 402 PF00515 Tetratricopeptide TPR_1

IPR001440 435 468 PF00515 Tetratricopeptide TPR_1

IPR001440 477 510 PF00515 Tetratricopeptide TPR_1

IPR001440 519 552 PF00515 Tetratricopeptide TPR_1

IPR001440 561 594 PF00515 Tetratricopeptide TPR_1

IPR013105 603 636 PF07719 Tetratricopeptide TPR_2

HMMSmart IPR013026 285 318 SM00028 Tetratricopeptide region

IPR013026 327 360 SM00028 Tetratricopeptide region

IPR013026 369 402 SM00028 Tetratricopeptide region

IPR013026 435 468 SM00028 Tetratricopeptide region

IPR013026 477 510 SM00028 Tetratricopeptide region

IPR013026 519 552 SM00028 Tetratricopeptide region

IPR013026 561 594 SM00028 Tetratricopeptide region

IPR013026 603 636 SM00028 Tetratricopeptide region

ProfileScan IPR013026 285 318 PS50005 Tetratricopeptide region

IPR013026 285 636 PS50293 Tetratricopeptide region

IPR013026 327 360 PS50005 Tetratricopeptide region

IPR013026 369 402 PS50005 Tetratricopeptide region

IPR013026 435 468 PS50005 Tetratricopeptide region

IPR013026 477 510 PS50005 Tetratricopeptide region

IPR013026 519 552 PS50005 Tetratricopeptide region

IPR013026 561 594 PS50005 Tetratricopeptide region

IPR013026 603 636 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002151	428	447	PR00381	Kinesin light chain
IPR002151	450	468	PR00381	Kinesin light chain
IPR002151	515	532	PR00381	Kinesin light chain
IPR002151	559	579	PR00381	Kinesin light chain
IPR002151	594	615	PR00381	Kinesin light chain
HMMPfam	IPR001440	285	318	PF00515	Tetratricopeptide TPR_1
IPR001440	327	360	PF00515	Tetratricopeptide TPR_1
IPR001440	369	402	PF00515	Tetratricopeptide TPR_1
IPR001440	435	468	PF00515	Tetratricopeptide TPR_1
IPR001440	477	510	PF00515	Tetratricopeptide TPR_1
IPR001440	519	552	PF00515	Tetratricopeptide TPR_1
IPR001440	561	594	PF00515	Tetratricopeptide TPR_1
IPR013105	603	636	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR013026	285	318	SM00028	Tetratricopeptide region
IPR013026	327	360	SM00028	Tetratricopeptide region
IPR013026	369	402	SM00028	Tetratricopeptide region
IPR013026	435	468	SM00028	Tetratricopeptide region
IPR013026	477	510	SM00028	Tetratricopeptide region
IPR013026	519	552	SM00028	Tetratricopeptide region
IPR013026	561	594	SM00028	Tetratricopeptide region
IPR013026	603	636	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	285	318	PS50005	Tetratricopeptide region
IPR013026	285	636	PS50293	Tetratricopeptide region
IPR013026	327	360	PS50005	Tetratricopeptide region
IPR013026	369	402	PS50005	Tetratricopeptide region
IPR013026	435	468	PS50005	Tetratricopeptide region
IPR013026	477	510	PS50005	Tetratricopeptide region
IPR013026	519	552	PS50005	Tetratricopeptide region
IPR013026	561	594	PS50005	Tetratricopeptide region
IPR013026	603	636	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAAACAAGACCAGCAAAGCC

Primer_r
: CTGCCCAAATCCTTAGTCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3704 bp
Genome contig ID	gi89161205r_133659676
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TGAACATTAGGAATTAAAGGCTATATCTGGTCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATTTTGTAATTTGTTTCTCTGTCTGAGGAAAGCTGGCTGGATTGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	133759676	133923993	45	99.7	Perfect prediction

Primer_f	: CTAAACAAGACCAGCAAAGCC
Primer_r	: CTGCCCAAATCCTTAGTCTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2000

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information