HUGE

Gene/Protein Characteristic Table for KIAA1985

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06821
Accession No. :	AB075865
Description :	SH3 domain and tetratricopeptide repeats-containing protein 2.
HUGO Gene Name :	SH3 domain and tetratricopeptide repeats 2 (SH3TC2)
Clone Name :	pf00647 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 7327 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3366 bp

Genome contig ID gi51511721r_148261104
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CATCTAATCTAAATAAAGAACAAGAAGGGCATTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATTGTGGAAAACCCTGTAACATGTTTTCTCAGCTTTCAGGTATACTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 148361104 148422800 18 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 955 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI13880	99.9	SH3 domain and ...	Homo sapiens
EAW61795	99.8	hCG1979865, iso...	Homo sapiens
AAI14487	99.8	SH3TC2 protein ...	Homo sapiens
XP_001161962	99.4	SH3 domain and ...	Pan troglodytes
XP_001162001	99.4	SH3 domain and ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028966	0.00016	24.5	KIAA1043

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 503 536 PF00515 Tetratricopeptide TPR_1

IPR001440 833 866 PF00515 Tetratricopeptide TPR_1

HMMSmart IPR013026 195 228 SM00028 Tetratricopeptide region

IPR013026 503 536 SM00028 Tetratricopeptide region

IPR013026 711 744 SM00028 Tetratricopeptide region

IPR013026 833 866 SM00028 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	503	536	PF00515	Tetratricopeptide TPR_1
IPR001440	833	866	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	195	228	SM00028	Tetratricopeptide region
IPR013026	503	536	SM00028	Tetratricopeptide region
IPR013026	711	744	SM00028	Tetratricopeptide region
IPR013026	833	866	SM00028	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGAATCCATCCAGAATCCTC

Primer_r
: TTAGGTCCATGAGCAGTTCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3366 bp
Genome contig ID	gi51511721r_148261104
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CATCTAATCTAAATAAAGAACAAGAAGGGCATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTGTGGAAAACCCTGTAACATGTTTTCTCAGCTTTCAGGTATACTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	148361104	148422800	18	99.2	Perfect prediction

Primer_f	: TTGAATCCATCCAGAATCCTC
Primer_r	: TTAGGTCCATGAGCAGTTCCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1985

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information