HUGE

Gene/Protein Characteristic Table for KIAA1980

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07238
Accession No. :	AB075860
Description :	Tetratricopeptide repeat protein 14.
HUGO Gene Name :	tetratricopeptide repeat domain 14 (TTC14)
Clone Name :	fj10323s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj10323, former representative clones for KIAA1980 with fj10323s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 2419 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 436 bp

Genome contig ID gi89161205f_181703650
PolyA signal sequence
(ATTAAA,-28)
+----*----+----*----+----*----+----
CTGTTAAATTAAAAATCGTCAGCTTTTGAAAGATT
Flanking genome sequence
(107812 - 107861)
----+----*----+----*----+----*----+----*----+----*
ATATGTTCGAATGTTTCTTGAACACTTTTATATTTATCAGTTTAAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 181803650 181811460 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96N46	2.6e-209	100.0	Tetratricopepti...	Homo sapiens
XP_001495821	1.7e-195	93.7	tetratricopepti...	Equus caballus
XP_001927220	9.8e-191	92.3	tetratricopepti...	Sus scrofa
XP_535814	1.6e-185	90.0	similar to tetr...	Canis lupus fam...
XP_848442	1.6e-185	90.0	similar to tetr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013105 197 230 PF07719 Tetratricopeptide TPR_2

IPR001440 231 264 PF00515 Tetratricopeptide TPR_1

IPR001440 272 305 PF00515 Tetratricopeptide TPR_1

HMMSmart IPR013026 197 230 SM00028 Tetratricopeptide region

IPR013026 231 264 SM00028 Tetratricopeptide region

IPR013026 272 305 SM00028 Tetratricopeptide region

ProfileScan IPR003029 16 98 PS50126 S1

IPR013026 197 230 PS50005 Tetratricopeptide region

IPR013026 197 305 PS50293 Tetratricopeptide region

IPR013026 231 264 PS50005 Tetratricopeptide region

IPR013026 272 305 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	197	230	PF07719	Tetratricopeptide TPR_2
IPR001440	231	264	PF00515	Tetratricopeptide TPR_1
IPR001440	272	305	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	197	230	SM00028	Tetratricopeptide region
IPR013026	231	264	SM00028	Tetratricopeptide region
IPR013026	272	305	SM00028	Tetratricopeptide region
ProfileScan	IPR003029	16	98	PS50126	S1
IPR013026	197	230	PS50005	Tetratricopeptide region
IPR013026	197	305	PS50293	Tetratricopeptide region
IPR013026	231	264	PS50005	Tetratricopeptide region
IPR013026	272	305	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGCCCACTTAGAAATCACAG

Primer_r
: TGGAAGAGAAGAGCTATACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	436 bp
Genome contig ID	gi89161205f_181703650
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- CTGTTAAATTAAAAATCGTCAGCTTTTGAAAGATT
Flanking genome sequence (107812 - 107861)	----+--------+--------+--------+--------+----* ATATGTTCGAATGTTTCTTGAACACTTTTATATTTATCAGTTTAAATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	181803650	181811460	10	100.0	Perfect prediction

Primer_f	: TAGCCCACTTAGAAATCACAG
Primer_r	: TGGAAGAGAAGAGCTATACAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1980

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information