HUGE

Gene/Protein Characteristic Table for KIAA1978

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05739
Accession No. :	AB075858
Description :	Ribonucleoprotein PTB-binding 1.
HUGO Gene Name :	ribonucleoprotein, PTB-binding 1 (RAVER1)
Clone Name :	fj03313 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4694 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3365 bp

Genome contig ID gi42406306r_10187891
PolyA signal sequence
(ATTAAA,-30)
+----*----+----*----+----*----+----
GCTGAATTAAAGTTTGTAAGTAAATGGTTTTAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATCAGAGTTGGCTGGTTCTTGGGACAAACAGTGGGCTTGAGTGGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 10287891 10305187 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 384 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IY67	4.1e-109	81.3	Ribonucleoprote...	Homo sapiens
NP_597709	4.8e-109	89.4	RAVER1 [Homo sa...	Homo sapiens
EAW84094	5.5e-109	89.4	hCG2033729, iso...	Homo sapiens
XP_001105380	1.8e-107	88.3	similar to Rave...	Macaca mulatta
AAI23486	9.8e-105	81.4	RAVER1 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046799	1e-46	49.9	KIAA1579

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 55 126 PF00076 RNA recognition motif

IPR000504 178 215 PF00076 RNA recognition motif

HMMSmart IPR000504 54 127 SM00360 RNA recognition motif

IPR000504 143 216 SM00360 RNA recognition motif

ProfileScan IPR000504 53 131 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	55	126	PF00076	RNA recognition motif
IPR000504	178	215	PF00076	RNA recognition motif
HMMSmart	IPR000504	54	127	SM00360	RNA recognition motif
IPR000504	143	216	SM00360	RNA recognition motif
ProfileScan	IPR000504	53	131	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTCATTATGTCTCTGGCTTG

Primer_r
: CTCGAAAGGCCAAAATTACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3365 bp
Genome contig ID	gi42406306r_10187891
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- GCTGAATTAAAGTTTGTAAGTAAATGGTTTTAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCAGAGTTGGCTGGTTCTTGGGACAAACAGTGGGCTTGAGTGGGAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	10287891	10305187	10	99.3	Perfect prediction

Primer_f	: CCTCATTATGTCTCTGGCTTG
Primer_r	: CTCGAAAGGCCAAAATTACAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1978

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information