HUGE

Gene/Protein Characteristic Table for KIAA1945

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04049
Accession No. :	AB075825
Description :	Arginine decarboxylase.
HUGO Gene Name :	arginine decarboxylase (ADC)
Clone Name :	fh14407 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5848 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2410 bp

Genome contig ID gi89161185f_33219959
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GCAAATAAATAAATATTTAGGTTTTTAAAAACTGC
Flanking genome sequence
(138761 - 138810)
----+----*----+----*----+----*----+----*----+----*
AGCGGAATCTGGCAGTTTGATTCACAAAGCAGCCTGGGCTAGGCCTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 33319847 33358718 7 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX07477	6.2e-176	100.0	arginine decarb...	Homo sapiens
EAX07470	6.8e-176	100.0	arginine decarb...	Homo sapiens
Q96A70	3.3e-170	100.0	Arginine decarb...	Homo sapiens
EAX07471	3.7e-170	100.0	arginine decarb...	Homo sapiens
AAQ62560	1.6e-169	99.7	arginine decarb...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002433 44 68 PR01182 Ornithine decarboxylase

IPR002433 70 97 PR01182 Ornithine decarboxylase

IPR000183 72 90 PR01179 Orn/DAP/Arg decarboxylase 2

IPR000183 92 104 PR01179 Orn/DAP/Arg decarboxylase 2

IPR002433 114 138 PR01182 Ornithine decarboxylase

IPR002433 144 166 PR01182 Ornithine decarboxylase

IPR000183 194 207 PR01179 Orn/DAP/Arg decarboxylase 2

IPR000183 277 296 PR01179 Orn/DAP/Arg decarboxylase 2

IPR002433 326 339 PR01182 Ornithine decarboxylase

IPR002433 360 370 PR01182 Ornithine decarboxylase

IPR002433 380 393 PR01182 Ornithine decarboxylase

IPR000183 393 406 PR01179 Orn/DAP/Arg decarboxylase 2

HMMPfam IPR000183 50 288 PF02784 Orn/DAP/Arg decarboxylase 2

IPR000183 291 414 PF00278 Orn/DAP/Arg decarboxylase 2

ScanRegExp IPR000183 72 90 PS00878 Orn/DAP/Arg decarboxylase 2

IPR000183 228 245 PS00879 Orn/DAP/Arg decarboxylase 2

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002433	44	68	PR01182	Ornithine decarboxylase
IPR002433	70	97	PR01182	Ornithine decarboxylase
IPR000183	72	90	PR01179	Orn/DAP/Arg decarboxylase 2
IPR000183	92	104	PR01179	Orn/DAP/Arg decarboxylase 2
IPR002433	114	138	PR01182	Ornithine decarboxylase
IPR002433	144	166	PR01182	Ornithine decarboxylase
IPR000183	194	207	PR01179	Orn/DAP/Arg decarboxylase 2
IPR000183	277	296	PR01179	Orn/DAP/Arg decarboxylase 2
IPR002433	326	339	PR01182	Ornithine decarboxylase
IPR002433	360	370	PR01182	Ornithine decarboxylase
IPR002433	380	393	PR01182	Ornithine decarboxylase
IPR000183	393	406	PR01179	Orn/DAP/Arg decarboxylase 2
HMMPfam	IPR000183	50	288	PF02784	Orn/DAP/Arg decarboxylase 2
IPR000183	291	414	PF00278	Orn/DAP/Arg decarboxylase 2
ScanRegExp	IPR000183	72	90	PS00878	Orn/DAP/Arg decarboxylase 2
IPR000183	228	245	PS00879	Orn/DAP/Arg decarboxylase 2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTCCAAGACCATCGTGTAC

Primer_r
: ACGCAATCACAGCCATCAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2410 bp
Genome contig ID	gi89161185f_33219959
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GCAAATAAATAAATATTTAGGTTTTTAAAAACTGC
Flanking genome sequence (138761 - 138810)	----+--------+--------+--------+--------+----* AGCGGAATCTGGCAGTTTGATTCACAAAGCAGCCTGGGCTAGGCCTGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	33319847	33358718	7	99.6	Perfect prediction

Primer_f	: ACCTCCAAGACCATCGTGTAC
Primer_r	: ACGCAATCACAGCCATCAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1945

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information