HUGE |
Gene/Protein Characteristic Table for KIAA1918 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05262 |
---|---|
Accession No. : | AB067505 |
Description : | Polypeptide N-acetylgalactosaminyltransferase 13. |
HUGO Gene Name : | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13) (GALNT13) |
Clone Name : | hj01313 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4978 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3425 bp Genome contig ID gi89161199f_154605095 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
TGAAATATGAAATTTTATTAAAATGCTGCTATATTFlanking genome sequence
(413641 - 413690) ----+----*----+----*----+----*----+----*----+----*
ACATAAGTTGCTTCATTAAGCTAAAAATGGTTTTTATTTTTTGGTTGTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 154705090 155018734 10 99.2 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 516 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCTGACAAAGAAATCCGAACC | |
: TCATCGAGACATTGGTTACTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |