HUGE

Gene/Protein Characteristic Table for KIAA1918

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05262
Accession No. :	AB067505
Description :	Polypeptide N-acetylgalactosaminyltransferase 13.
HUGO Gene Name :	UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13) (GALNT13)
Clone Name :	hj01313 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4978 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3425 bp

Genome contig ID gi89161199f_154605095
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TGAAATATGAAATTTTATTAAAATGCTGCTATATT
Flanking genome sequence
(413641 - 413690)
----+----*----+----*----+----*----+----*----+----*
ACATAAGTTGCTTCATTAAGCTAAAAATGGTTTTTATTTTTTGGTTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 154705090 155018734 10 99.2 Terminal No-hit

Features of the protein sequence	Description

Length: 516 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IUC8	100.0	Polypeptide N-a...	Homo sapiens
BAC54545	100.0	UDP-N-acetyl-al...	Homo sapiens
AAI23663	99.6	UDP-N-acetyl-al...	Bos taurus
Q8CF93	99.4	Polypeptide N-a...	Mus musculus
Q6UE39	99.4	Polypeptide N-a...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032956	7.8e-78	44.6	KIAA1130

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001173 78 262 PF00535 Glycosyl transferase

IPR000772 389 507 PF00652 Ricin B lectin

HMMSmart IPR000772 387 510 SM00458 Ricin B lectin

ProfileScan IPR000772 398 510 PS50231 Ricin B lectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001173	78	262	PF00535	Glycosyl transferase
IPR000772	389	507	PF00652	Ricin B lectin
HMMSmart	IPR000772	387	510	SM00458	Ricin B lectin
ProfileScan	IPR000772	398	510	PS50231	Ricin B lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTGACAAAGAAATCCGAACC

Primer_r
: TCATCGAGACATTGGTTACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3425 bp
Genome contig ID	gi89161199f_154605095
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TGAAATATGAAATTTTATTAAAATGCTGCTATATT
Flanking genome sequence (413641 - 413690)	----+--------+--------+--------+--------+----* ACATAAGTTGCTTCATTAAGCTAAAAATGGTTTTTATTTTTTGGTTGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	154705090	155018734	10	99.2	Terminal No-hit

Primer_f	: GCTGACAAAGAAATCCGAACC
Primer_r	: TCATCGAGACATTGGTTACTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1918

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information