HUGE

Gene/Protein Characteristic Table for KIAA1914

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04061
Accession No. :	AB067501
Description :	Actin filament-associated protein 1-like 2.
HUGO Gene Name :
Clone Name :	fk06306 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3700 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2094 bp

Genome contig ID gi89161187r_115944575
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTAGGTTTTTTAAAATAAAATGTTCATTGTATTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTTTTCCTCAGTTCATGAAATGACTTGGGGCAGGGCCTGGGGGGTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 116044575 116051766 6 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 460 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH11936	3.2e-110	96.3	unnamed protein...	Homo sapiens
BAF84401	9.4e-110	96.0	unnamed protein...	Homo sapiens
AAQ05765	1.2e-109	95.7	XB130 [Homo sap...	Homo sapiens
BAH12099	5.1e-108	95.1	unnamed protein...	Homo sapiens
BAG53870	9.1e-108	95.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGGAAATTGACGAGGAGTGC

Primer_r
: GAGTGTGGTTGCAGAGTTGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2094 bp
Genome contig ID	gi89161187r_115944575
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAGGTTTTTTAAAATAAAATGTTCATTGTATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTTTTCCTCAGTTCATGAAATGACTTGGGGCAGGGCCTGGGGGGTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	116044575	116051766	6	99.4	Perfect prediction

Primer_f	: AAGGAAATTGACGAGGAGTGC
Primer_r	: GAGTGTGGTTGCAGAGTTGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1914

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information