HUGE |
Gene/Protein Characteristic Table for KIAA1909 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07571 |
---|---|
Accession No. : | AB067496 |
Description : | |
HUGO Gene Name : | pleckstrin homology domain containing, family G (with RhoGef domain) member 4B (PLEKHG4B) |
Clone Name : | ff10210 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh11423, former representative clones for KIAA1909 with ff10210. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 11527 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 7661 bp Genome contig ID gi51511721f_93373 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAAAAAAAAAAGGGCGACCGCTCGCGATCTAGAAFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 193373 280063 22 99.2 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1287 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 825 | 991 | PF00621 | DH |
IPR001849 | 1019 | 1115 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR000219 | 825 | 999 | SM00325 | DH |
IPR001849 | 1013 | 1122 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000219 | 821 | 1000 | PS50010 | DH |
IPR001849 | 1012 | 1120 | PS50003 | Pleckstrin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGAATTTGAAGGAACAGGGG | |
: TTCTCTGTCATCCCGATCTCG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |