HUGE

Gene/Protein Characteristic Table for KIAA1903

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04318
Accession No. :	AB067490
Description :	Uncharacterized potential DNA-binding protein C14orf106.
HUGO Gene Name :	chromosome 14 open reading frame 106 (C14orf106)
Clone Name :	hk10325 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4382 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 523 bp

Genome contig ID gi51511730r_44642540
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
ATTACACATTGTTGAAATTAAATTACACATTGTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATGCTTCTCTCCTGATTGTTTTTATTTTAAACTTGTGATAGGCATATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 44742540 44792355 17 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1014 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6P0N0	0	99.7	Mis18-binding p...	Homo sapiens
XP_522841	0	98.4	chromosome 14 o...	Pan troglodytes
XP_001151604	0	98.2	chromosome 14 o...	Pan troglodytes
XP_001915365	4.7e-139	73.7	similar to chro...	Equus caballus
XP_001925327	7.7e-121	65.0	similar to chro...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR015216 265 357 PF09133 SANT associated

IPR014778 759 808 PF00249 Myb

HMMSmart IPR001005 758 810 SM00717 SANT

ProfileScan IPR001005 762 804 PS50090 SANT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015216	265	357	PF09133	SANT associated
IPR014778	759	808	PF00249	Myb
HMMSmart	IPR001005	758	810	SM00717	SANT
ProfileScan	IPR001005	762	804	PS50090	SANT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATGAGGTATAATCTGTCCGC

Primer_r
: TAAGTAAGTCACGTTCATCGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	523 bp
Genome contig ID	gi51511730r_44642540
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATTACACATTGTTGAAATTAAATTACACATTGTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGCTTCTCTCCTGATTGTTTTTATTTTAAACTTGTGATAGGCATATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	44742540	44792355	17	99.7	Perfect prediction

Primer_f	: CATGAGGTATAATCTGTCCGC
Primer_r	: TAAGTAAGTCACGTTCATCGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1903

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information