| HUGE |
Gene/Protein Characteristic Table for KIAA1879 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05726 |
|---|---|
| Accession No. : | AB067466 |
| Description : | polycystin 1-like 2 isoform c. |
| HUGO Gene Name : | polycystic kidney disease 1-like 2 (PKD1L2) |
| Clone Name : | ah00647 [Vector Info] |
| Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5834 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 367 bp Genome contig ID gi51511732r_79621468 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTCCAGCCTGGGAGACAGAGCAAGACTCTGTCTTFlanking genome sequence
(99719 - 99670) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGAGGCCAGGTGCAGTGGCTTACGCCTATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 79721187 79781786 26 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 995 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : AAATCCCCACAGCTCTGCAAG | |
| : GCACATGCTCTCTGACCTTCT | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |