| HUGE |
Gene/Protein Characteristic Table for KIAA1877 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07003 |
|---|---|
| Accession No. : | AB058780 |
| Description : | ST6 beta-galactosamide alpha-2,6-sialyltranferase 2. |
| HUGO Gene Name : | ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 (ST6GAL2) |
| Clone Name : | pg00264 [Vector Info] |
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6782 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 5073 bp Genome contig ID gi89161199r_106684492 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TTTTTCTTGTAAATAAAACATGTTTTCATTTGTCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGAAGTTTCTTGTTTTAATTCGTAGAAGTTACACATACAAATGAGCAAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 106784492 106869042 6 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 534 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : ATGAGTGCCAGTATGTGATTG | |
| : TCTGATAATTCCCCTGGTCCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : CCR | |
| : ATGAGTGCCAGTATGTGATTG | |
| : TCTGATAATTCCCCTGGTCCC | |
| : 95 bp | |
| : 15 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |