| HUGE |
Gene/Protein Characteristic Table for KIAA1858 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05723 |
|---|---|
| Accession No. : | AB058761 |
| Description : | |
| HUGO Gene Name : | zinc finger protein 469 (ZNF469) |
| Clone Name : | ae00147 [Vector Info] |
| Source : | Human brain (amygdala) |
| Note : | We replaced fh12352, former representative clones for KIAA1858 with ae00147. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 8855 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1443 bp Genome contig ID gi51511732f_86925830 PolyA signal sequence
(AATATA,-24) +----*----+----*----+----*----+----
TTGTCTTTTCAAATATATTCCCACTATTTTCGCAGFlanking genome sequence
(108830 - 108879) ----+----*----+----*----+----*----+----*----+----*
AAAACCTCCAGCTGCGTGACGTCTGTCCTCCCGCCGGCCCCCATCCCTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 87025830 87034658 2 99.0 Internal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2469 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCAGCCCTTTTGAGACCACAC | |
| : CAACAGCAGCAAGACTAAGAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : GCAGCCCTTTTGAGACCACAC | |
| : CAACAGCAGCAAGACTAAGAG | |
| : 95 bp | |
| : 15 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |