HUGE

Gene/Protein Characteristic Table for KIAA1855

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07236
Accession No. :	AB058758
Description :	Tau-tubulin kinase 1.
HUGO Gene Name :	tau tubulin kinase 1 (TTBK1)
Clone Name :	fg04654 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6697 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2883 bp

Genome contig ID gi89161210f_43228499
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
AGCCATCACACCATTAAAAAGCCTGTGGACCTTTT
Flanking genome sequence
(135478 - 135527)
----+----*----+----*----+----*----+----*----+----*
TCTGTTGGCTTGGACTCTTCTTCCCTGAGGGAGGGCAGGCAAAACCCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 43328499 43363975 13 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1270 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TCY1	100.0	Tau-tubulin kin...	Homo sapiens
BAE78660	100.0	brain-derived t...	Homo sapiens
EAX04169	100.0	tau tubulin kin...	Homo sapiens
XP_001088342	97.4	similar to tau ...	Macaca mulatta
Q6PCN3	89.2	Tau-tubulin kin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 5 204 PD000001 Protein kinase

HMMPfam IPR000719 1 109 PF00069 Protein kinase

IPR000719 125 189 PF00069 Protein kinase

HMMSmart IPR002290 1 257 SM00220 Serine/threonine protein kinase

IPR001245 3 242 SM00219 Tyrosine protein kinase

ProfileScan IPR000719 1 246 PS50011 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	5	204	PD000001	Protein kinase
HMMPfam	IPR000719	1	109	PF00069	Protein kinase
IPR000719	125	189	PF00069	Protein kinase
HMMSmart	IPR002290	1	257	SM00220	Serine/threonine protein kinase
IPR001245	3	242	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	1	246	PS50011	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAAGGACAAGGAACAGGTAG

Primer_r
: CTCTCCTTCATGCTGTTCTCA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCATTTCCCAGCTCCTCACAG
Primer_r	: AACATTCTTAGGTGGCTTCCC
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec130 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2883 bp
Genome contig ID	gi89161210f_43228499
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AGCCATCACACCATTAAAAAGCCTGTGGACCTTTT
Flanking genome sequence (135478 - 135527)	----+--------+--------+--------+--------+----* TCTGTTGGCTTGGACTCTTCTTCCCTGAGGGAGGGCAGGCAAAACCCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	43328499	43363975	13	100.0	Perfect prediction

Primer_f	: TCAAGGACAAGGAACAGGTAG
Primer_r	: CTCTCCTTCATGCTGTTCTCA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1855

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information