HUGE

Gene/Protein Characteristic Table for KIAA1842

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05568
Accession No. :	AB058745
Description :	Kelch repeat and BTB domain-containing protein 8.
HUGO Gene Name :	kelch repeat and BTB (POZ) domain containing 8 (KBTBD8)
Clone Name :	fj22905s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj22905, former representative clones for KIAA1842 with fj22905s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4403 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2821 bp

Genome contig ID gi89161205f_67036307
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTCATTGTTTCTTATAATAAAACCTTTTCTGATTG
Flanking genome sequence
(108015 - 108064)
----+----*----+----*----+----*----+----*----+----*
AAAACTTCCAGTGTTGCAAAGTGATATCTGACTAGTGAGTGTTGCAGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 67136306 67144320 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 526 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM43839	100.0	T-cell activati...	Homo sapiens
Q8NFY9	100.0	Kelch repeat an...	Homo sapiens
XP_001087631	98.3	similar to T-ce...	Macaca mulatta
XP_608990	98.1	kelch repeat an...	Bos taurus
EDL91413	97.9	similar to T-ce...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040922	2.3e-32	31.6	KIAA1489
D50922	1e-24	28.3	KIAA0132
AB051474	1.7e-24	26.3	KIAA1687
AB040923	3.7e-23	26.3	KIAA1490
AB037799	1.3e-22	25.8	KIAA1378

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 1 72 PF00651 BTB/POZ

IPR011705 77 179 PF07707 BTB/Kelch-associated

IPR006652 256 302 PF01344 Kelch repeat type 1

IPR006652 304 353 PF01344 Kelch repeat type 1

IPR006652 395 441 PF01344 Kelch repeat type 1

HMMSmart IPR006652 261 315 SM00612 Kelch repeat type 1

IPR006652 316 366 SM00612 Kelch repeat type 1

IPR006652 407 457 SM00612 Kelch repeat type 1

ProfileScan IPR000210 1 42 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	1	72	PF00651	BTB/POZ
IPR011705	77	179	PF07707	BTB/Kelch-associated
IPR006652	256	302	PF01344	Kelch repeat type 1
IPR006652	304	353	PF01344	Kelch repeat type 1
IPR006652	395	441	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	261	315	SM00612	Kelch repeat type 1
IPR006652	316	366	SM00612	Kelch repeat type 1
IPR006652	407	457	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	1	42	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGTCTGAGCCTATGCCTATC

Primer_r
: TGGAAGAGAAGGTTGGGCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2821 bp
Genome contig ID	gi89161205f_67036307
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCATTGTTTCTTATAATAAAACCTTTTCTGATTG
Flanking genome sequence (108015 - 108064)	----+--------+--------+--------+--------+----* AAAACTTCCAGTGTTGCAAAGTGATATCTGACTAGTGAGTGTTGCAGAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	67136306	67144320	2	99.0	Perfect prediction

Primer_f	: TGGTCTGAGCCTATGCCTATC
Primer_r	: TGGAAGAGAAGGTTGGGCTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1842

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information