HUGE

Gene/Protein Characteristic Table for KIAA1822

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05420
Accession No. :	AB058725
Description :
HUGO Gene Name :
Clone Name :	fh13781 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5399 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3795 bp

Genome contig ID gi51511730f_99088804
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAGCCCACTTACCATGCATAACAGACAAGTCCCAT
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 99188804 99215470 8 99.2 Terminal No-hit

Features of the protein sequence	Description

Length: 533 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JK4	1.9e-183	100.0	HHIP-like prote...	Homo sapiens
BAE28276	1.1e-153	83.0	unnamed protein...	Mus musculus
Q14DK5	1.2e-153	83.0	HHIP-like prote...	Mus musculus
AAI13774	1.2e-153	83.0	Hedgehog intera...	Mus musculus
EDL18717	1.7e-153	82.8	mCG18356 [Mus m...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001190 426 442 PR00258 Speract/scavenger receptor

IPR001190 445 456 PR00258 Speract/scavenger receptor

IPR001190 460 470 PR00258 Speract/scavenger receptor

IPR001190 492 506 PR00258 Speract/scavenger receptor

IPR001190 515 527 PR00258 Speract/scavenger receptor

HMMPfam IPR001190 429 527 PF00530 Speract/scavenger receptor

HMMSmart IPR001190 424 527 SM00202 Speract/scavenger receptor

ProfileScan IPR001190 424 527 PS50287 Speract/scavenger receptor

ScanRegExp IPR001190 431 468 PS00420 Speract/scavenger receptor

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001190	426	442	PR00258	Speract/scavenger receptor
IPR001190	445	456	PR00258	Speract/scavenger receptor
IPR001190	460	470	PR00258	Speract/scavenger receptor
IPR001190	492	506	PR00258	Speract/scavenger receptor
IPR001190	515	527	PR00258	Speract/scavenger receptor
HMMPfam	IPR001190	429	527	PF00530	Speract/scavenger receptor
HMMSmart	IPR001190	424	527	SM00202	Speract/scavenger receptor
ProfileScan	IPR001190	424	527	PS50287	Speract/scavenger receptor
ScanRegExp	IPR001190	431	468	PS00420	Speract/scavenger receptor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTGATGCTGTGCCAAGTTCT

Primer_r
: TCCAAGACAGTGACCTAAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3795 bp
Genome contig ID	gi51511730f_99088804
PolyA signal sequence (None)	+--------+--------+----*----+---- TAGCCCACTTACCATGCATAACAGACAAGTCCCAT
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	99188804	99215470	8	99.2	Terminal No-hit

Primer_f	: GGTGATGCTGTGCCAAGTTCT
Primer_r	: TCCAAGACAGTGACCTAAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1822

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information