HUGE

Gene/Protein Characteristic Table for KIAA1791

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04501
Accession No. :	AB058694
Description :	Cell division cycle 2-like protein kinase 5.
HUGO Gene Name :
Clone Name :	fh26241 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 566 bp

Genome contig ID gi89161213f_39965786
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAACACAACCTTTCTCTTGATGCAACAGTTTTAT
Flanking genome sequence
(135886 - 135935)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATGGTCAACGTTATTTTTGTTTTGTTTTGCAGATTATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 40065786 40101670 8 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14004	0	99.4	Cell division c...	Homo sapiens
CAC10400	0	99.2	CDC2L5 protein ...	Homo sapiens
XP_001139939	0	99.2	cell division c...	Pan troglodytes
XP_001915656	6.6e-216	97.2	similar to cell...	Equus caballus
XP_533082	6.7e-213	95.9	similar to Cell...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020711	4.9e-36	44.0	KIAA0904
AB020641	3.4e-05	34.3	KIAA0834
AB023153	0.00015	26.2	KIAA0936

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 9 130 PD000001 Protein kinase

HMMPfam IPR000719 8 139 PF00069 Protein kinase

HMMSmart IPR002290 1 139 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 1 139 PS50011 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	9	130	PD000001	Protein kinase
HMMPfam	IPR000719	8	139	PF00069	Protein kinase
HMMSmart	IPR002290	1	139	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	139	PS50011	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTACTGCTTCATCTCATTCTG

Primer_r
: CAGGACTGCAATAGGACCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	566 bp
Genome contig ID	gi89161213f_39965786
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAACACAACCTTTCTCTTGATGCAACAGTTTTAT
Flanking genome sequence (135886 - 135935)	----+--------+--------+--------+--------+----* AAAAAAAAAAATGGTCAACGTTATTTTTGTTTTGTTTTGCAGATTATCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	40065786	40101670	8	99.3	Perfect prediction

Primer_f	: GTACTGCTTCATCTCATTCTG
Primer_r	: CAGGACTGCAATAGGACCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1791

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information