HUGE

Gene/Protein Characteristic Table for KIAA1702

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07476
Accession No. :	AB051489
Description :	Zinc finger protein 451.
HUGO Gene Name :
Clone Name :	fj15966 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4380 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2504 bp

Genome contig ID gi89161210f_56972978
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGCTTCCCCTTCCCTTTGCCTTTTAAATTGTGGTT
Flanking genome sequence
(104384 - 104433)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAAAAAGGCACATAAAGCTGAGCACCTTAACCATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 57072978 57077360 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX04473	8.4e-197	100.0	hCG1737847 [Hom...	Homo sapiens
CAH71222	1e-194	99.8	zinc finger pro...	Homo sapiens
XP_001110436	2.7e-192	99.2	hypothetical pr...	Macaca mulatta
AAH19546	2e-174	89.4	Zfp451 protein ...	Mus musculus
BAB29981	1.8e-152	88.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR002114 408 423 PS00589 Phosphotransferase system

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002114	408	423	PS00589	Phosphotransferase system

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCCATGCCAGTGTTCTCTAC

Primer_r
: TCCAGTGGCAAGTCCTCTAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: CCR
Primer_f	: GTCCATGCCAGTGTTCTCTAC
Primer_r	: TCCAGTGGCAAGTCCTCTAAG
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2504 bp
Genome contig ID	gi89161210f_56972978
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCTTCCCCTTCCCTTTGCCTTTTAAATTGTGGTT
Flanking genome sequence (104384 - 104433)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAAAAAGGCACATAAAGCTGAGCACCTTAACCATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	57072978	57077360	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1702

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information