HUGE

Gene/Protein Characteristic Table for KIAA1669

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07248
Accession No. :	AB051456
Description :	Gamma-tubulin complex component 6.
HUGO Gene Name :	tubulin, gamma complex associated protein 6 (TUBGCP6)
Clone Name :	fh18133 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5605 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1385 bp

Genome contig ID gi89161203r_48898251
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TCTGCGGGGGACGTGCACAATAAAGGTGTTCTCGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCTGTCTGCAGCTCTCTCTCCTGGGTGGGGGCTGAGGACAGGGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 48998251 49024921 24 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW73509	99.9	tubulin, gamma ...	Homo sapiens
AAI51210	99.1	TUBGCP6 protein...	Homo sapiens
Q96RT7	98.7	Gamma-tubulin c...	Homo sapiens
NP_065194	98.7	tubulin, gamma ...	Homo sapiens
EAW73508	98.6	tubulin, gamma ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007259 320 1239 PF04130 Spc97/Spc98

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007259	320	1239	PF04130	Spc97/Spc98

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1385 bp
Genome contig ID	gi89161203r_48898251
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCTGCGGGGGACGTGCACAATAAAGGTGTTCTCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGTCTGCAGCTCTCTCTCCTGGGTGGGGGCTGAGGACAGGGCAGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	48998251	49024921	24	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1669

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information