HUGE

Gene/Protein Characteristic Table for KIAA1606

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05324
Accession No. :	AB046826
Description :	GON-4-like protein.
HUGO Gene Name :
Clone Name :	fj10873 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4155 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 866 bp

Genome contig ID gi89161185r_153750269
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAGCCATAGGGTGAATAAAGGAATGTTTAACTGTG
Flanking genome sequence
(235865 - 235816)
----+----*----+----*----+----*----+----*----+----*
GACTTTTTCAGCACTTTTAATCCAGGAATGGAGATAGTAAAACCTCTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 153986134 154002453 12 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW53030	100.0	gon-4-like (C.e...	Homo sapiens
Q3T8J9	99.9	GON-4-like prot...	Homo sapiens
BAF51556	99.6	YY1AP-related p...	Homo sapiens
XP_513864	99.1	Dingo protein [...	Pan troglodytes
XP_001915796	87.2	gon-4-like (C. ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003822 501 549 PF02671 Paired amphipathic helix

IPR003822 583 630 PF02671 Paired amphipathic helix

ProfileScan IPR001005 1010 1055 PS50090 SANT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003822	501	549	PF02671	Paired amphipathic helix
IPR003822	583	630	PF02671	Paired amphipathic helix
ProfileScan	IPR001005	1010	1055	PS50090	SANT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTACAACATATCCCTGGCAAG

Primer_r
: CTCAGGTAACAGGAAAGCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	866 bp
Genome contig ID	gi89161185r_153750269
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGCCATAGGGTGAATAAAGGAATGTTTAACTGTG
Flanking genome sequence (235865 - 235816)	----+--------+--------+--------+--------+----* GACTTTTTCAGCACTTTTAATCCAGGAATGGAGATAGTAAAACCTCTCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	153986134	154002453	12	99.8	Perfect prediction

Primer_f	: CTACAACATATCCCTGGCAAG
Primer_r	: CTCAGGTAACAGGAAAGCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1606

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information